@article {10.3844/ajavsp.2025.245.254, article_type = {journal}, title = {Molecular Identification of Domestic and Wild Boars Using Cytochrome-b Specific Primers for Halal Authentication}, author = {Rifqi, and Suryanto, Edi and Sukarno, Ari Surya and Rusman, and Fitriyanto, Nanung Agus and Rohman, Abdul and Erwanto, Yuny}, volume = {20}, number = {3}, year = {2025}, month = {Nov}, pages = {245-254}, doi = {10.3844/ajavsp.2025.245.254}, url = {https://thescipub.com/abstract/ajavsp.2025.245.254}, abstract = {The subject of adulterating wild boar and pig meat products with other animal meat is delicate, particularly in the Muslim nation of Indonesia. In recent years, there has been a lot of concern over halal meat products that contain wild boar and pig meat due to Economically Motivated Adulteration (EMA). However, there are limited studies of PCR-DNA-based to discriminate between domestic pigs and wild boars. This study aims to design species-specific primers to identify wild boar in the cytochrome-B gen region. DNA from seven animals (wild boar, pig, cow, sheep, goat, chicken, and fish) was extracted. Both conventional and real-time PCR were used for qualitative and quantitative identification. The cytochrome-B gene of wild boar and pig was sequenced, and this region was then used to design primers using Prime Quest. Designed primers were characterized by four criteria: specificity, sensitivity, limit detection, and repetition tests. The set of primers designed for amplification consisted of Cyt-B Forward1715'CGAGACGTAAATTACGGATGAC'3 and Reverse-4885'GGTAATGATGAAGGGCAGGATG'3. The results of this study showed the primer amplificated wild boar DNA, specifically with an annealing temperature of 53°C, performed in a 25 cycle RT-PCR system. Good recommendations were shown by the sensitivity test (R2 = 0.9817, slope = -3,4742, y-intercept = 30,625; and efficiency = 94%). In conclusion, the adulteration of wild boar meat in food products can be detected using a specially designed primer. The proposed primer can be used to identify wild boars in products sold on the commercial market, according to the results of qualitative and quantitative tests.}, journal = {American Journal of Animal and Veterinary Sciences}, publisher = {Science Publications} }